Review



itaq universal probes supermix bio rad  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Bio-Rad itaq universal probes supermix bio rad
    Itaq Universal Probes Supermix Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 881 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/itaq+universal+probes/ITaq+Universal+Supermix+For+Probes/pmc13181333-191-35-39
    Average 99 stars, based on 881 article reviews
    itaq universal probes supermix bio rad - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Quantitative RT-PCR:

    Article Title: Insulin-independent glucose uptake in skeletal muscle by coupled SGLT and Na,K-ATPase transport
    Article Snippet: RNA pellets were dissolved and stored in FORMAzol (Molecular Research Center, Inc.) at -80 C. For subsequent reactions, RNA was precipitated from FORMAzol, resuspended in nuclease-free water, treated with DNase I (Thermo Fisher Scientific), and quantified (NanoDrop ND-2000C Spectrophotometer, Thermo Fisher Scientific). .. Slc5a gene family transcripts were measured by RT-qPCR (StepOnePlus Real-Time PCR System (Applied Biosystems); iTaq Universal Probes One-Step Kit (Bio-Rad)). ..

    Article Title: Susceptibility of wild and domestic songbirds to Usutu virus
    Article Snippet: .. RT-qPCR was performed using the iTaq Universal Probes One-Step Kit (Bio-Rad Laboratories) and USUV primers (forward: 5’ CAAAGCTGGACAGACATCCCTTAC 3’, reverse: 5’ CGTAGATGTTTTCAGCCCACGT 3’) and probe (5’ FAM-AAGACATATGGTGTGGAAGCCTGATAGGCA 3’) targeting a conserved region of USUV NS5 as described previously [ ]. ..

    Article Title: A new mRNA antigen vaccine induces potent B and T cell responses and in vivo protection against SARS-CoV-2.
    Article Snippet: After homogenization, RNA was extracted using a QuickDNA/RNA Miniprep Plus Kit (Zymo Research). .. Reverse transcription and qRT-PCR were performed using an iTaq Universal Probes One-Step Kit (Bio-Rad) on Roche LightCycler480 System. .. Viral loads were quantified using a SARS-CoV-2 Standard (BioRad).

    Article Title: Rational Design of a Chimpanzee Adenoviral-Vector Vaccine Against Yellow Fever Through the Modification of Antigen Transmembrane Domains.
    Article Snippet: .. To profile the gene expression for pro-inflammatory cytokines (IP-10, OAS-1) in the liver [21,22], RT-qPCR was performed on a Light Cycler 96 platform (Roche, Machelen, Belgium) using the iTaq Universal Probes One-Step RT-qPCR Kit (BioRad) with primers https://doi.org/10.3390/vaccines14030273 and probes. ..

    Article Title: Susceptibility of wild and domestic songbirds to Usutu virus.
    Article Snippet: .. RT-qPCR was performed using the iTaq Universal Probes One-Step Kit (Bio-Rad Laboratories) and USUV primers (forward: 5’ CAAAGCTGGACAGACATCCCTTAC 3’, reverse: 5’ CGTAGATGTTTTCAGCCCACGT 3’) and probe (5’ FAM-AAGACATATGGTGTGGAAGCCTGATAGGCA 3’) targeting a conserved region of USUV NS5 as described previously [36]. ..

    Article Title: Rational Design of a Chimpanzee Adenoviral-Vector Vaccine Against Yellow Fever Through the Modification of Antigen Transmembrane Domains
    Article Snippet: .. To profile the gene expression for pro-inflammatory cytokines (IP-10, OAS-1) in the liver [ , ], RT-qPCR was performed on a Light Cycler 96 platform (Roche, Machelen, Belgium) using the iTaq Universal Probes One-Step RT-qPCR Kit (BioRad) with primers and probes. ..

    Real-time Polymerase Chain Reaction:

    Article Title: Insulin-independent glucose uptake in skeletal muscle by coupled SGLT and Na,K-ATPase transport
    Article Snippet: RNA pellets were dissolved and stored in FORMAzol (Molecular Research Center, Inc.) at -80 C. For subsequent reactions, RNA was precipitated from FORMAzol, resuspended in nuclease-free water, treated with DNase I (Thermo Fisher Scientific), and quantified (NanoDrop ND-2000C Spectrophotometer, Thermo Fisher Scientific). .. Slc5a gene family transcripts were measured by RT-qPCR (StepOnePlus Real-Time PCR System (Applied Biosystems); iTaq Universal Probes One-Step Kit (Bio-Rad)). ..

    Article Title: Understanding the Rift Valley fever exposure risk: A comparative perspective from a multi-country study in East and Central Africa, 2021-24.
    Article Snippet: The QIAamp Viral RNA Mini kit (Qiagen, Germany) was used for nucleic acid extraction according to the manufacturer’s instructions. .. A one step real-time RT (reverse-transcription)-PCR was performed using the iTaq Universal Probes One-Step Kit (Biorad) on a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, USA). ..

    Reverse Transcription:

    Article Title: Pathogenic Leptospira in dogs and rodents in Tha Wang Pha, Thailand – Prevalence, diversity and linked environments
    Article Snippet: .. Amplifications were done using the iTaq® Universal Probes One-Step kit (Biorad, USA) using the following conditions: reverse transcription at 50°C for 10 minutes, initial denaturation at 95°C for 3 minutes, followed by 45 cycles of denaturation for 15 seconds at 95°C and annealing/extension for 15 seconds at 58°C. .. Samples with doubtful results (unusual PCR curve and/or very late Ct) were retested using the Quantinova® Probe PCR kit (QIAGEN, Germany) using the conditions: initial denaturation at 95°C for 2 minutes, and 45 cycles of denaturation for 5 seconds at 95°C and annealing/extension for 5 seconds at 60°C.

    Article Title: A new mRNA antigen vaccine induces potent B and T cell responses and in vivo protection against SARS-CoV-2.
    Article Snippet: After homogenization, RNA was extracted using a QuickDNA/RNA Miniprep Plus Kit (Zymo Research). .. Reverse transcription and qRT-PCR were performed using an iTaq Universal Probes One-Step Kit (Bio-Rad) on Roche LightCycler480 System. .. Viral loads were quantified using a SARS-CoV-2 Standard (BioRad).

    Gene Expression:

    Article Title: Rational Design of a Chimpanzee Adenoviral-Vector Vaccine Against Yellow Fever Through the Modification of Antigen Transmembrane Domains.
    Article Snippet: .. To profile the gene expression for pro-inflammatory cytokines (IP-10, OAS-1) in the liver [21,22], RT-qPCR was performed on a Light Cycler 96 platform (Roche, Machelen, Belgium) using the iTaq Universal Probes One-Step RT-qPCR Kit (BioRad) with primers https://doi.org/10.3390/vaccines14030273 and probes. ..

    Article Title: Rational Design of a Chimpanzee Adenoviral-Vector Vaccine Against Yellow Fever Through the Modification of Antigen Transmembrane Domains
    Article Snippet: .. To profile the gene expression for pro-inflammatory cytokines (IP-10, OAS-1) in the liver [ , ], RT-qPCR was performed on a Light Cycler 96 platform (Roche, Machelen, Belgium) using the iTaq Universal Probes One-Step RT-qPCR Kit (BioRad) with primers and probes. ..



    Similar Products

    99
    Bio-Rad itaq universal probes supermix bio rad
    Itaq Universal Probes Supermix Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/itaq+universal+probes/ITaq+Universal+Supermix+For+Probes/pmc13181333-191-35-39
    Average 99 stars, based on 1 article reviews
    itaq universal probes supermix bio rad - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad itaq universal probes supermix
    Itaq Universal Probes Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/itaq+universal+probes/ITaq+Universal+Supermix+For+Probes/pmc13178061-76-3-7
    Average 99 stars, based on 1 article reviews
    itaq universal probes supermix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    96
    Bio-Rad one step kit
    One Step Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/itaq+universal+probes/iTaq+Universal+Probes+One-Step+Kit/pm42108281-194-11-13
    Average 96 stars, based on 1 article reviews
    one step kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    99
    Bio-Rad itaqtm universal probes supermix
    Itaqtm Universal Probes Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/itaq+universal+probes/ITaq+Universal+Probes+SMX+1000/pm42007969-78-106-110
    Average 99 stars, based on 1 article reviews
    itaqtm universal probes supermix - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad probe
    Probe, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/itaq+universal+probes/ITaq+Universal+Probes+SMX+1000/pmc13094670-68-292-299
    Average 99 stars, based on 1 article reviews
    probe - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results